| 產(chǎn)品名稱 |
Paxillus involutus (Batsch : Fries) Fries |
| 商品貨號 |
B244716 |
| Strain Designations |
ATCC 200175 [87.017] |
| Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format |
frozen |
| Storage Conditions |
Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain |
no |
| Preceptrol® |
no |
| Genome Sequenced Strain |
Yes
|
| Comments |
Amino acid uptake. Cadmium uptake. Poisonous mushroom. Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA). |
| Morphology |
On YM agar, after 35 days at 25°C, colonies are white to creamy, velutinous, dense, radially sulcate, and exudate is brown to dark brownin color. Clamp connections present on hyphae, spores not observed. |
| Medium |
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 2798: MMNC Medium
|
| Growth Conditions |
Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal?? transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence. CATTATCGAAAAGCAATCCGGGGGGAGGCGACCGAGCGAAGTTTGGTAGATCGTAGGGATTGTCGCTGGCCTTTGGAAACGAAGGCATGTGCACGTTCCGAGTTCTCCTTAGTCCTCCTTTGCCTTTCCTTTGGAAAACCCTTTCTTCACACCCGTGCACCCATTGTAGGTCTCCGCGAGGGGATCTATGTCTTCACATAAACACTACGTATGTCTAGGAATGTATCTAAAAGCGTCGGACGGCTTGGCTTCGTGCCCGGTCGGCGACGGTAAAGAACCATAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTCTCAACCATCCCTCGATTCGTTTCGAGGGTTTGGCTTGGATTTTGGGGGCTGCCGGGCGACCCTAGGGTCTTCGGCTCTCCTTGAAAGCATTAGCGATGGCGGCGCGATCTAACCCCCCC
D1D2 region of the 28S ribosomal RNA gene
CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGATGAGCTCAAATTTCGAATCTGGCGGTCTTCAGGCCGTCCGAGTTGTAATCTAGAGAAGCGTCTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAATCGGGTGGTAAACTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAGGTCAGTCGCGTCGGACGGGGATCAACCTTGCTTCTCGCTCGGTGTACTTCCTGCTCGACGGGTCAGCATCAGTTTCGGTCGCCGTACAAGGGTCGAGGGAATGTGGCACTCCTCGGAGTGTGTTATAGCCTTCGGTCGCATGCGGTGGTTGGGACTGAGGAACTCAGCACGACCCCTCGAGGGTTCGGGGCCACGGCCTACGTTAACGTGCTTAGGATGCTGGCATAATGGCCTTAAGCGA
|
| Name of Depositor |
T Johansson |
| Special Collection |
ATCC |
| Chain of Custody |
ATCC <-- T Johansson |
| Isolation |
Birch plantation, Bush Estate, Penicuik, Midlothian, Scotland. |
| Cross References |
Nucleotide (GenBank) :
HQ999961
ITS including 5.8S rRNA gene
Nucleotide (GenBank) :
JOMD00000000
Paxillus involutus ATCC 200175, whole genome shotgun sequencing project
|
| References |
Kohler A, et al. Convergent losses of decay mechanisms and rapid turnover of symbiosis genes in mycorrhizal mutualists. Nat Genet 47: 410-415, 2015. PubMed: 25706625
Blaudez D, et al. Cadmium uptake and subcellular compartmentation in the ectomycorrhizal fungus Paxillus involutus. Microbiology 146: 1109-1117, 2000. PubMed: 10832638
Chalot M, et al. Kinetics, energetics and specificity of a general amino acid transporter from the ectomycorrhizal fungus Paxillus involutus. Microbiology 142: 1749-1756, 1996.
Chalot M, et al. Factors affecting amino acid uptake by the ectomycorrhizal fungus Paxillus involutus. Mycol. Res. 99: 1131-1138, 1995.
|